ПОЛИМОРФИЗМ ГЕНОВ ГЛУТАТИОН S ТРАНСФЕРАЗ У ЖИТЕЛЕЙ КЕМЕРОВСКОЙ ОБЛАСТИ БОЛЬНЫХ РАКОМ ЛЕГКОГО

А. В. Рыжкова

Научный руководитель: канд. биол. наук, доц. В. И. Минина

Институт экологии человека СО РАН, г. Кемерово

Введение. Рак легкого (РЛ) занимает лидирующее положение в структуре онкологической заболеваемости мужчин в мире, в России и Кемеровской области. В разных географических регионах среди мужчин ежегодно регистрируется от 5,3 до 99,7 новых случаев РЛ на 100000 че ловек в год. В России ежегодно от РЛ погибает свыше 60000 человек, что составляет более 20% всех умерших от злокачественных опухолей [1]. Развитие злокачественной опухоли — многофакторный и многоста дийный процесс, в основе развития которого лежит сочетанное воздей ствие экзогенных и эндогенных факторов. Для РЛ наиболее важными эк зогенными факторами считаются: курение, загрязнение окружающей и производственной среды, воздействие излучений радона и продуктов его распада. К эндогенным факторам следует отнести индивидуальные особенности функционирования защитных систем организма (система метаболизма ксенобиотиков, репарации ДНК, иммунная система и др.), эффективность работы которых генетически детерминирована.

Гены GSTM1 и GSTT1 вовлечены в детоксикацию мутагенных про межуточных метаболитов, образующихся в организме, под действием ферментов первой фазы биотрансформации. У человека GSTM1 лока лизован на 1 хромосоме в области 1р13.3. GSTT1 осуществляет деток сикацию, главным образом токсичных галогенпроизводных углеводоро дов, в избытке содержащихся в атмосфере. GSTT1 картирован на 22 хромосоме в локусе 22q11.2. Генотип GSTM1 0/0 повышает чувстви тельность к химическим канцерогенам, предрасполагает к раку легких. В целом, данные литературы говорят о том, что нулевой вариант гена GSTM1 предрасполагает к тем видам злокачественных образований, для которых в качестве этиологического фактора служит табачный дым (tobaccolinked cancers), в то время как для GSTT1 0/0 такая связь в большинстве случаев не характерна [5].

В ряде работ показано, что функциональную значимость в развитии онкопатологии может иметь не один конкретный рисковый генотип, а их специфическая комбинация. Например, было отмечено, что повышен ный риск РЛ у курильщиков европеоидной расы имеют индивиды с ком бинацией генотипов GSTM1нуль, GSTP1 AG+GG и GSTM3 AA [4]. Мно гообразие и противоречивость литературных данных относительно ас социаций между полиморфизмом генов GST и риском РЛ, влияние на результаты исследований множества «дополнительных» факторов (та ких как национальность, вредные привычки, воздействие факторов

окружающей среды, а также влияние полиморфных вариантов других генов) обусловливает необходимость продолжения подобных исследо ваний. Особую актуальность приобретает изучение роли полиморфных маркеров генов в формировании риска РЛ в популяциях, подвергаю щихся интенсивному воздействию канцерогенных факторов. Примером могут служить группы жителей Кемеровской области, на территории ко торой активно ведется угледобыча, приводя к мощному техногенному загрязнению окружающей среды.

В связи с этим, целью данного исследования стало изучение поли морфизма генов GST у больных раком легкого и здоровых людей, про живающих в Кемеровской области.

Материал и методы. В программу исследования были включены

367 мужчин. Из них в исследуемую группу вошло 242 человека больных раком легкого, поступивших на лечение в Кемеровский областной онкологический диспансер. Группу сравнения составили 125 здоровых людей, также проживающих в Кемеровской области и не имеющих онколо гических заболеваний. Средний возраст в группах составляет 50 лет.

Для выполнения молекулярногенетических исследований у всех обследованных доноров была забрана венозная кровь на антикоагулян те (0,25 мМ ЭДТАNa), с последующим получением лейковзвеси. Выделение ДНК из этого биологического материала проводилось методом фенолхлороформной экстракции. Образцы ДНК растворяли в 10 mM Tris/1 EDTA, pH 8.0 и хранили при 20o C. Тестсистемы для молекуляр ногенетического анализа полиморфизмов GSTM1 и GSTT1 разработа ны ИХБФМ СО РАН (г. Новосибирск).

Типирование генов GSTM1 и GSTT1 проводили методом мульти плексной ПЦР с флуоресцентной детекцией результатов в режиме ре ального времени. Для исключения отсутствия флуоресцентного сигнала в связи с отсутствием ДНК или ингибированием ПЦР в реакционные смеси добавлялись в качестве внутреннего контроля ПЦР праймеры LTM (low temperature melting) (5’TGGGTGCTAGAGGTATAATCG3’ и 5’ TTAGAGGAAGCTGGGTAAGAG3’). Амплификацию осуществляли с применением методики hotстарт, при этом праймеры и dNTP с помо щью парафина отделяются от ДНК и Taqполимеразы. Амплификацию проводили с помощью амплификатора iCycler iQ5 (BioRad, США). ПЦР проводили при следующих условиях: начальная денатурация 2 мин при

95°С, далее 40 циклов при следующих условиях: денатурация 10 сек. при 95°С, отжиг праймеров 10 сек. при 66°С, элонгация 10 сек. при 72°С, регистрация флуоресцентного сигнала 10 сек. при 78°С, затем 10 сек.

при 85°С. Затем регистрировали кривые плавления: 60 циклов по 10 сек. с повышением температуры на 0,5°С в каждом цикле начальная тем пература составила 65°С для GSTM1+LTM и 70°С для GSTT1+LTM, регистрацию флуоресцентного сигнала производили в каждом цикле. По

лученные результаты интерпретировали исходя из анализа графиков накопления флуоресценции, специфичность оценивалась с помощью кривой плавления. Температура плавления составляла 85°С для GSTM1 и 91°С для GSTT1. Отсутствие флуоресцентного сигнала указывало на гомозиготность индивидуума по делеции гена («0»). Гетерозиготы по му тации (генотип «+/0») рассматривались в одной группе с носителями нормальных генов («+»).

Статистическая обработка результатов проводилась с использова нием пакета прикладных программ «STATISTICA for Windows 6.0». При сравнении частот генотипов применяли стандартный критерий χ2 Пир сона. При условии, когда объем выборки не превышал 10 случаев, ис пользовали критерий χ2 с поправкой Йетса (Y), когда объем выборки не превышал 5 случаев – критерий Фишера (F). Различия статистически значимы при р<0,05.

Результаты и обсуждение. Частота встречаемости генотипа GSTT null в группе больных РЛ составляет 21,9%, тогда как в группе сравне ния 31,06%. Наблюдаемые различия оказались статистически недосто верными (р = 0,677).

Частота встречаемости генотипа GSTMnull в группе больных РЛ со ставляет 35,9%, тогда как в группе сравнения 41,6%. Наблюдаемые

различия так же оказались статистически недостоверными( р = 0,345). Анализ комбинаций генотипов GSTT и GSTM не показал достоверных

отличий частоты их встречаемости в группах РЛ и здоровых доноров.

По данным современной литературы, GSTM1null генотип оценива ется как вероятный фактор риска для развития РЛ. Но для некоторых популяций статистическая значимость ассоциаций подтверждена не была. Так, например, в бразильской популяции не находили значимого увеличения риска развития РЛ, связанного с 0/0 генотипом GSTM1 [3]. Литературные данные по полиморфизму гена GSTT1 при РЛ противоре чивы. Увеличение частоты нулевого аллеля отмечено у китайской, ази атской популяций, у жителей Мексики, Индии, Дании, у европеоидов

GSTT1*0 увеличивал риск для аденокарциномы и плоскоклеточной формы РЛ. В ряде работ показано, что функциональную значимость в

развитии онкопатологии может иметь не один мутантный генотип, а их специфическая комбинация. Было отмечено, что риск РЛ увеличивается для людей, одновременно несущих делецию генов GSTM1 и GSTT[2].

Выводы. Ассоциаций между делеционными полиморфизмами ге нов GSTT1 и GSTM1 и риском развития рака легкого в Кемеровской по пуляции не обнаружено, что может быть как особенностью данной выборки, так и недостаточным объемом исследованных групп.

Список литературы:

1. Мерабишвили В. М., Дятченко О. Т. Статистика рака легкого (заболеваемость, смертность, выживаемость) // Практич. oнкол. –2000. – Т. 3. – С. 3–7.

2. CajasSalazar N., SierraTorres C. H., Salama S. A. et al. Combined effect of MPO, GSTM1 and GSTT1 polymorphisms on chromosome aberrations and lung cancer risk // Int. J. of Hygiene and Env. Health. – 2003. – V. 206, Iss.6. – P. 473483.

3. Honma H., De Capitani Eduardo M, Perroud Jr. Maurício W. et

al. http://www. sciencedirect. com/science/article/pii/S0169500207007313 – aff1#aff1

Influence of p53 codon 72 exon 4, GSTM1, GSTT1 and GSTP1*B polymorphisms in lung cancer risk in a Brazilian population //Lung Cancer. – 2008. – Vol. 61, Issue 2. –

P. 152162.

4. JourenkowaMironova N., Wikman H., Bouchardy C. et al. Role of glutathione S transferase GSTM1, GSTM3, GSTP1 and GSTT1 genotypes in modulating suscepti bility to smokingrelated lung cancer // Pharmacogenetics. – 1998. – V. 8. – P. 495502.

5. Saarikoski ST, Voho A, Reinikainen M. et al. Combined effect of polymorphic GST genes on individual susceptibility to lung cancer // Int. J. Cancer. – 1998. – Vol. 77. – P.516521.

Материал взят из: Медикобиологические науки: достижения и перспективы (г. Томск, 10-11 ноября 2011 г.): сборник материалов I Всероссийской научной студенческой конференции